REL RCSB RCSB RCSB 2015-08-26 2015-09-23 2016-02-17 2016-04-13 Ballandras-Colas A Brown M Cook N Demeler B Cherepanov P Lyumkis D Engelman AN integration, retrovirus, integrase Ballandras-Colas A Brown M Cook NJ Dewdney TG Demeler B Cherepanov P Lyumkis D Engelman AN NATURE 530 358 361 2016 26887496 doi:10.1038/nature16955 3jca FULLOVERLAP Mouse Mammary Tumor Virus intasome complex Mouse Mammary Tumor Virus intasome complex

IN-NTD and IN-CCD domains of flanking INs 5-8 computationally removed. The oligomeric state of the computationally processed sample is therefore an IN tetramer + IN-CTD tetramer + two vDNAs.

Integrase octamer bound to two vDNA strands 2 194 sedimentation velocity centrifugation betaretroviral integrase Mouse mammary tumor virus MMTV 0.036 8 octamer true Escherichia coli BL21(DE3) PC2 pET-15b MMTV U5 DNA end Mouse mammary tumor virus MMTV 0.013 CAGGTCGGCCGACTGCGGCA DNA DOUBLE HELIX true singleParticle particle 7.4

25 mM Tris-HCl, 200 mM NaCl, 2 mM DTT, 25 uM ZnCl2, 10 mM CaCl2

400 mesh C-flat, plasma-treated for 6 seconds

ETHANE 90 77 HOMEMADE PLUNGER 3 uL of sample was applied to the grid, adsorbed for 30 seconds, blotted, and plunge-frozen in liquid ethane. FEI TITAN KRIOS FLOOD BEAM BRIGHT FIELD FIELD EMISSION GUN 300 2.7 1.0 4.0 22500.0 38167.0 FEI TITAN KRIOS AUTOGRID HOLDER Objective lens astigmatism was corrected using Leginon, and coma-free alignment was established. 2015-04-15 GATAN K2 (4k x 4k) 2714 40

IN-NTD and IN-CCD domains of flanking INs 5-8 were computationally removed using Relion after assigning Euler angles to full octameric particles and masking out the flanking regions.

each particle

OTHER 4.8 OTHER Frealign

Local FSC values range from 5 to 6 Angstrom.

30307

Frealign, phi, theta, psi