REL RCSB RCSB RCSB 2015-01-04 2015-01-14 2015-01-14 2016-02-10 The export receptor Crm1 forms a dimer to promote nuclear export of HIV RNA Booth DS Cheng Y Frankel AD RNA Nuclear Export, HIV-host interactions, Human Crm1, Human Ran, HIV-1 Rev, HIV-1 Rev Response Element Booth DS Cheng Y Frankel AD The export receptor Crm1 forms a dimer to promote nuclear export of HIV RNA. eLife 3 e04121 e04121 2014 25486595 doi:10.7554/eLife.04121 A dimer of human Crm1/RanGTP bound to the HIV Rev-RRE complex A dimer of human Crm1/RanGTP bound to the HIV Rev-RRE complex Crm1/RanGTP dimer, HIV-1 Rev homohexamer, HIV-1 RRE monomer 4 0.462 0.457 Multi-angle laser light scattering Crm1 Homo sapiens Human Nucleus, cytoplasm 0.125 0.124 2 Dimer true Escherichia coli BL21(DE3) pET19b O14980 GO:0005487 GO:0016032 GO:0019058 GO:0008536 IPR016024 IPR011989 IPR001494 IPR013598 IPR014877 Ran Homo sapiens Human Nucleus, cytoplasm 0.026 0.025
Mutation of Gln69Leu with guanosine tri-phosphate bound.
2 Monomer true Escherichia coli BL21(DE3) pET19b P62826 GO:0005525 GO:0005487 GO:0016032 GO:0019058 IPR027417 IPR002041 IPR005225 IPR001806 Rev Human immunodeficiency virus 1 HXB3 HIV-1 Nucleus, cytoplasm of host human cells 0.013 6 Hexamer true Escherichia coli BL21(DE3) pHGB1 P04618 GO:0016032 GO:0019058 GO:0051028 GO:0003723 GO:0042025 GO:0030430 GO:0005515 IPR000625 Rev Response Element Human immunodeficiency virus 1 SF-2 HIV-1 0.080
245-nucleotide portion of the 351-nucleotide Rev Response Element from the HIV-1 genome
GGGCUAGUAGGAGCUAUGUUCCUUGGGUUCUUGGGAGCAGCAGGAAGCACUAUGGGCGCAGUGUCAUUGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCAACAGCAGAACAAUUUGCUGAGGGCUAUUGAGGCGCAACAACAUCUGUUGCAACUCACAGUCUGGGGCAUCAAGCAGCUCCAGGCAAGAGUCCUGGCUGUGGAAAGAUACCUAAGGGAUCAACAGCUCCUAGGGG OTHER SINGLE STRANDED true singleParticle particle 0.1 7.4
50 mM HEPES-KOH, 50 mM potassium chloride, 2 mM magnesium acetate, 2 mM 2-mercaptoethanol, 2% v/v glycerol
 NEGATIVE
0.75% w/v uranyl formate
200 mesh copper grid with thin carbon support, glow discharged
 NONE OTHER FEI TECNAI 12 FLOOD BEAM BRIGHT FIELD LAB6 120 2 1.5 6.0 52000.0 SIDE ENTRY, EUCENTRIC 0 2012-12-05 GATAN ULTRASCAN 4000 (4k x 4k) 44 40 0 60
Random conical tilt reconstructions were generated from samples tilted to 60 degrees using angular parameters from class averages of untilted particles. The structure was further refined by projection matching using both tilted and untilted particles.
Each particle
 OTHER 25.0 OTHER FREALIGN, Spider 845 5 emd_6231.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 80 80 80 -40 -40 -40 80 80 80 323.2 323.2 323.2 90.0 90.0 90.0 X Y Z -0.20516232 1.0428586 -0.0182145 0.09284244 4.04 4.04 4.04 0.31 AUTHOR Random conical tilt reconstruction from negative-stain electron micrographs of a human Crm1/RanGTP dimer bound to the HIV-1 Rev-RRE complex.
::::EMDATABANK.org::::EMD-6231::::
 3GB8 A RIGID BODY FIT Chimera
A human Crm1 dimer was extracted from the unit cell of the crystal structure.
Correlation REAL