REL RCSB RCSB RCSB 2009-07-30 2009-08-24 2009-11-04 2012-05-21 Three-dimensional EM structure of an intact activator-dependent transcription initiation complex Hudson BP Quispe J Lara S Kim Y Berman HM Arnold E Ebright RH Lawson CL transcription, initiation, Class I, activator, RNA polymerase, holoenzyme, sigma70, open complex, CAP, CRP, cAMP-dependent, DNA, prokaryotic Hudson BP Quispe J Lara S Kim Y Berman HM Arnold E Ebright RH Lawson CL Three-dimensional EM structure of an intact activator-dependent transcription initiation complex. PROC.NAT.ACAD.SCI.USA 106 19830 19835 2009 19903881 doi:10.1073/pnas.0908782106 3iyd FULLOVERLAP E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble
Complex formation was verified by gel shift
One molecule of RNAP (containing six subunits) and one CAP homodimer bound to a DNA duplex) 3 0.57 Catabolite Activator Protein Escherichia coli K12 0.05 1 homodimer true Escherichia coli BL21(DE3) pET21(a) GO:0006355 IPR001808 lac(ICAP)UP-UV5-bubble unidentified 0.06 0.06
An engineered 98mer duplex based on positions -78 to 20 of the Class I CAP-dependent promoter lac but containing consensus -10 sequence and consensus binding sites for CAP and RNAP alpha-CTD. Positions -11 to 2 are non-complementary to create an artificial transcription bubble. Top strand 5'-CGCAATAAATGTGATCTAGATCACATTTTAGGCAAAAAAGGCTTTACACTTTATGCTTCCGGCTCGTATAATCGCACCTTATGTGAGCGGATAACAAG-3' Bottom strand 5'-CTTGTTATCCGCTCACAATTCCACACTAATAACGAGCCGGAAGCATAAAGTGTAAAGCCTTTTTTGCCTAAAATGTGATCTAGATCACATTTATTGCG-3'
DNA OTHER true RNA polymerase holoenzyme (sigma70) Escherichia coli K12 Escherichia coli 0.46
Six subunits include alphaI (RpoA), alphaII (RpoA), beta (RpoB), beta prime (RpoC) with C-terminal 6His-tag, omega (RpoZ), and sigma70.
1 heterohexamer true Escherichia coli BL21(DE3) pEcABC-H6, pRSFduet-sigma, pCDF-omega GO:0006351 singleParticle particle 6.18 8.0
25mM HEPES, 100mM KCl, 10mM MgCl2, 1mM DTT, 0.2mM cAMP
 NEGATIVE
Sample and 2% uranyl formate stain were applied to the grid in rapid succession, with the last drop of stain remaining on the sample for 1 minute. The grid was then submerged in stain and brought up under thin carbon to form an upper sandwich layer. The grid was then blotted and dried for 10 minutes.
400-mesh copper 2.0x0.5 hole pattern C-flat grid covered with thin layer of continuous carbon
 NONE OTHER FEI TECNAI F20 FLOOD BEAM BRIGHT FIELD FIELD EMISSION GUN 120 2.0 0.5 1.5 50000.0 SIDE ENTRY, EUCENTRIC 293
15 um pixel size on detector
2008-11-04 TVIPS TEMCAM-F415 (4k x 4k) 349 16 standard side-entry room-temperature stage
32816 particles were automatically selected by the Appion DoGpicker initially
ACE
 OTHER 19.8 FSC 0.5 CUT-OFF EMAN, SPIDER
EMAN interleaved with SPIDER correspondence analysis
14097 280 emd_5127.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 80 80 80 -40 -40 -40 80 80 80 371.19998 371.19998 371.19998 90.0 90.0 90.0 X Y Z -3.34078479 14.395241739999999 0.0 0.90271008 4.64 4.64 4.64 2.8 AUTHOR E. coli Class I transcription activation complex
::::EMDATABANK.org::::EMD-5127::::
 1LB2 RIGID BODY FIT Chimera, Yup.scx
Protocol: rigid body, Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
map-derived potential energy REAL 1BDF RIGID BODY FIT Chimera, Yup.scx
Protocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
map-derived potential energy REAL 2AUK A RIGID BODY FIT Chimera, Yup.scx
Protocol: manual fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
map-derived potential energy REAL 1SIG A RIGID BODY FIT Chimera, Yup.scx
Protocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
map-derived potential energy REAL 3DXJ RIGID BODY FIT Chimera, Modeller, Yup.scx
Protocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
map-derived potential energy REAL