2024-03-13 REL RCSB RCSB RCSB 2023-11-13 2023-12-20 2023-12-20 2024-03-13 National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS) R35GM122579 United States Howard Hughes Medical Institute (HHMI) United States National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS) U24GM129541 United States National Science Foundation (NSF, United States) GRFPDGE1656518 United States Ministry of Science and Technology (MoST, China) 2022YFC2303700 China Ministry of Science and Technology (MoST, China) 2022YFA1302700 China Other private BioX Bowes fellowship United States Other private BioX Interdisciplinary Initiative Program United States Other private ChEM-H COVID-19 Drug and Vaccine Prototyping seed grant United States Department of Energy (DOE, United States) Coronavirus CARES Act United States National Institutes of Health/National Institute Of Allergy and Infectious Diseases (NIH/NIAID) #U19AI171421 United States SARS-CoV-1 5' proximal stem-loop 5 Kretsch RC Xu L Zheludev IN Zhou X Huang R Nye G Li S Zhang K Chiu W Das R SL5, coronavirus, 5' UTR, RNA Kretsch RC Xu L Zheludev IN Zhou X Huang R Nye G Li S Zhang K Chiu W Das R Tertiary folds of the SL5 RNA from the 5' proximal region of SARS-CoV-2 and related coronaviruses. Proc.Natl.Acad.Sci.USA US 121 e2320493121 e2320493121 2024 38427602 doi:10.1073/pnas.2320493121 1091-6490 0040 PNASA6 Kretsch RC Xu L Zheludev IN Zhou X Huang R Nye G Li S Zhang K Chiu W Das R Tertiary folds of the SL5 RNA from the 5' proximal region of SARS-CoV-2 and related coronaviruses. Biorxiv US 2023 38076883 doi:10.1101/2023.11.22.567964 2692-8205 EMD-42809 other EM volume EMD-42810 other EM volume EMD-42811 other EM volume EMD-42801 other EM volume EMD-42805 other EM volume EMD-42802 other EM volume EMD-42808 other EM volume EMD-42803 other EM volume EMD-42813 other EM volume EMD-42814 other EM volume 8uyp FULLOVERLAP SARS-CoV-1 5' proximal stem-loop 5 SARS-CoV-1 5' proximal stem-loop 5 0 1 0.04614 SARS-CoV-1 5' proximal stem-loop 5 SARS coronavirus Tor2 0.045917073999999995 1 GGUUGACAAGAAACGAGUAACUCGUCCCUCUUCUGCAGACUGCUUACGGUUUCGUCCGUGUUGCAGUCGAUCAUCAGCAU ACCUAGGUUUCGUCCGGGUGUGACCGAAAGGUAAGAUGGAGAGCCUUGUUCUUGGUGUCAACC NC_004718.3 singleParticle particle 1.38 8.0 50.0 Na-C8H18N2O4S Sodium HEPES 10.0 MgCl2 Magnesium Chloride Quantifoil R1.2/1.3 COPPER 300 CARBON HOLEY GLOW DISCHARGE AIR ETHANE 100 278 FEI VITROBOT MARK IV TFS KRIOS FLOOD BEAM BRIGHT FIELD FIELD EMISSION GUN 300 70.0 2.7 1.0 2.0 105000.0 FEI TITAN KRIOS AUTOGRID HOLDER NITROGEN GATAN K3 (6k x 4k) 5760 4092 1 10376 0.59 50.0 1 1734565 1 C1 FOURIER SPACE 7.1 FSC 0.143 CUT-OFF cryoSPARC 3.2.0 Non-uniform Refinement 220917 MAXIMUM LIKELIHOOD cryoSPARC 3.2.0 Ab initio reconstruction multi-class MAXIMUM LIKELIHOOD cryoSPARC 3.2.0 Non-uniform Refinement 4 66169.0 cryoSPARC 3.2.0 Heterogeneous refinement emd_42816.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 380 380 380 0 0 0 380 380 380 326.80002 326.80002 326.80002 90.0 90.0 90.0 X Y Z -0.210425 0.39885843 0.00009142708 0.0070237406 0.8600001 0.8600001 0.8600001 0.13 AUTHOR SARS-CoV-1 RNA SL5 domain. OTHER REAL emd_42816_msk_1.map emd_42816_half_map_2.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 380 380 380 0 0 0 380 380 380 326.80002 326.80002 326.80002 90.0 90.0 90.0 X Y Z -0.04368263 0.2376198 0.00013785464 0.006976923 0.8600001 0.8600001 0.8600001 AUTHOR Half map of the SARS-CoV-1 RNA SL5 domain. emd_42816_half_map_1.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 380 380 380 0 0 0 380 380 380 326.80002 326.80002 326.80002 90.0 90.0 90.0 X Y Z -0.04404738 0.23730087 0.00013890585 0.0069788704 0.8600001 0.8600001 0.8600001 AUTHOR Half map of the SARS-CoV-1 RNA SL5 domain.