2025-04-09 REL RCSB RCSB RCSB 2023-10-26 2024-11-20 2024-11-20 2025-04-09 National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS) R35GM122579 United States Howard Hughes Medical Institute (HHMI) United States National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS) U24GM129541 United States National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS) R01GM079429 United States Chinese Academy of Sciences XDB0490000 China Other government Center for Advanced Interdisciplinary Science and Biomedicine of IHM QYPY20220019 Other government National Key R&D Program of China 2022YFC2303700 Other government National Key R&D Program of China 2022YFA1302700 Other government Fundamental Research Funds for the Central Universities WK9100000032 Other government Fundamental Research Funds for the Central Universities WK9100000044 Tetrahymena ribozyme with water and magnesium ions Kretsch RC Li S Pintilie G Palo MZ Case DA Das R Zhang K Chiu W Ribozyme, Magnesium ions, Water, RNA Kretsch RC Li S Pintilie G Palo MZ Case DA Das R Zhang K Chiu W Complex water networks visualized by cryogenic electron microscopy of RNA. Nature UK 2025 40068818 doi:10.1038/s41586-025-08855-w 1476-4687 0006 NATUAS 9cbu FULLOVERLAP 9cbx FULLOVERLAP Apo L-21 ScaI Tetrahymena ribozyme with water and metal ions. Apo L-21 ScaI Tetrahymena ribozyme with water and metal ions. 0 1 Tetrahymena thermophila 0.125 RNA (387-MER) Tetrahymena thermophila 0.125096773 1 GGAGGGAAAAGUUAUCAGGCAUGCACCUGGUAGCUAGUCUUUAAACCAAUAGAUUGCAUCGGUUUAAAAGGCAAGACCGU CAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGG UAAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUCA CAGACUAAAUGUCGGUCGGGGAAGAUGUAUUCUUCUCAUAAGAUAUAGUCGGACCUCUCCUUAAUGGGAGCUAGCGGAUG AAGUGAUGCAACACUGGAGCCGCUGGGAACUAAUUUGUAUGCGAAAGUAUAUUGAUUAGUUUUGGAG X54512.1 MAGNESIUM ION 2.4305e-05 23 MG water 1.8015e-05 137 HOH singleParticle particle 3.125 8.0 50.0 Na-C8H18N2O4S Sodium HEPES 10.0 MgCl2 Magnesium Chloride Quantifoil R2/1 COPPER 200 GLOW DISCHARGE AIR ETHANE 100 278 FEI VITROBOT MARK IV TFS KRIOS FLOOD BEAM BRIGHT FIELD FIELD EMISSION GUN 300 2.7 0.5 2.0 105000.0 FEI TITAN KRIOS AUTOGRID HOLDER NITROGEN GATAN K3 (6k x 4k) 18365 2.5 57.25 1 3804753 1 C1 FOURIER SPACE 2.2 FSC 0.143 CUT-OFF cryoSPARC Non-uniform Refinement 708006 MAXIMUM LIKELIHOOD cryoSPARC Ab initio reconstruction multi-class MAXIMUM LIKELIHOOD cryoSPARC Non-uniform Refinement 4 295333.0 cryoSPARC 3D variability emd_42499.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 256 256 256 0 0 0 256 256 256 209.92 209.92 209.92 90.0 90.0 90.0 Z Y X -44.264633000000003 66.177850000000007 -0.000000000003959 1.0 0.82 0.82 0.82 3.0 AUTHOR Single particle reconstruction of Tetrahymena ribozyme. 7EZ0 PDB experimental model FLEXIBLE FIT REAL 63.399999999999999 emd_42499_half_map_2.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 256 256 256 0 0 0 256 256 256 209.92 209.92 209.92 90.0 90.0 90.0 Z Y X -14.812837 44.201861999999998 0.000000000004959 1.0 0.82 0.82 0.82 AUTHOR emd_42499_half_map_1.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 256 256 256 0 0 0 256 256 256 209.92 209.92 209.92 90.0 90.0 90.0 Z Y X -21.477993000000001 49.809890000000003 0.000000000000029 1.0 0.82 0.82 0.82 AUTHOR