REL PDBe PDBe PDBe 2016-01-27 2016-02-03 2016-03-30 2016-04-13 Structure of human TFIID-IIA bound to core promoter DNA Louder RK He Y Lopez-Blanco JR Fang J Chacon P Nogales E TFIID, TFIIA, transcription, RNA polymerase II, general transcription factors, preinitiation complex, core promoter, DNA binding Louder RK He Y Lopez-Blanco JR Fang J Chacon P Nogales E Structure of promoter-bound TFIID and model of human pre-initiation complex assembly NATURE 531 604 609 2016 27007846 doi:10.1038/nature17394 Human TFIID-TFIIA complex bound to super core promoter DNA Human TFIID-TFIIA complex bound to super core promoter DNA 3 1.34 General transcription factor IID Homo sapiens HeLa Human Nucleus Nuclear extract 1.26 1 Monomer false General transcription factor IIA Homo sapiens Human 0.027 1 Monomer true Escherichia coli Super core promoter Homo sapiens 0.056
The super core promoter is a composite sequence combining promoter motifs from several strong promoters from humans and D. melanogaster.
GAAGGGCGCCTATAAAAGGGGGTGGGGGCGCGTTCGTCCTCAGTCGCGATCGAACACTCGAGCCGAGCAGACGTGCCTACGGACCATGG DNA DOUBLE HELIX true singleParticle particle 0.05 7.9
10 mM HEPES, 10 mM MgCl2, 50 mM KCl, 3% trehalose 1 mM DTT, 0.0125% NP-40
Amorphous continuous carbon over C-flat holey carbon support (4 um holes with 2 um spacing) on 400 mesh copper grid.
 ETHANE 100 FEI VITROBOT MARK IV Incubate 4 ul of sample on grid for 10 minutes, then blot for 4 seconds with force 15. FEI TITAN FLOOD BEAM BRIGHT FIELD FIELD EMISSION GUN 300 2.7 2.0 4.0 37879.0 GATAN LIQUID NITROGEN
The camera was operated in counting mode with a dose rate of 8 electrons/pixel per second, with a total exposure time of 10 seconds fractionated over 20 frames.
2014-08-11 GATAN K2 SUMMIT (4k x 4k) 1253 46
Whole-micrograph drift correction was performed using MotionCorr before averaging the frames.
Each particle
 C1 10.2 OTHER CTFFIND4, RELION, Bsoft
After whole micrograph drift correction, per-particle beam-induced motion and radiation damage were corrected using the particle polishing procedure within RELION. Final map was filtered according to local resolution using Bsoft.
56457 emd_3304.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 384 384 384 0 0 0 384 384 384 506.88 506.88 506.88 90.0 90.0 90.0 X Y Z -0.00777371 0.02985903 0.0001247 0.00110043 1.32 1.32 1.32 0.007 AUTHOR Reconstruction of human TFIID-IIA bound to super core promoter DNA.
::::EMDATABANK.org::::EMD-3304::::
emd_3304.png
emd_3304_fsc.xml