REL PDBe PDBe PDBe 2015-12-10 2016-01-27 2016-01-27 2016-03-16 Structures of a CRISPR-Cas9 R-loop complex primed for DNA cleavage Jiang F Taylor DW Chen JS Kornfeld JE Zhou K Thompson AJ Nogales E Doudna JA CRISPR-Cas, Cas9, genome editing Jiang F Taylor DW Chen JS Kornfeld JE Zhou K Thompson AJ Nogales E Doudna JA Structures of a CRISPR-Cas9 R-loop complex primed for DNA cleavage. SCIENCE 351 867 871 2016 26841432 doi:10.1126/science.aad8282 Cas9 bound to single guide-RNA and 40-bp target DNA Cas9 bound to single guide-RNA and 40-bp target DNA 3 0.218 CRISPR-associated endonuclease Cas9/Csn1 Streptococcus pyogenes serotype M1 0.158 1 monomer true Escherichia coli BL21 Q99ZW2 GO:0043571 GO:0051607 GO:0090305 GO:0003677 GO:0003723 GO:0004519 IPR028629 IPR032239 IPR032237 IPR032240 IPR025978 IPR003615 single guide-RNA Streptococcus pyogenes serotype M1 0.036 GGCGCAUAAAGAUGAGACGCGUUUUAGAGCUAUGCUGUUUUGAAAAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUCG OTHER OTHER true target 40-bp double stranded DNA lambda lambda 1 lambda phage 0.024
complementary strand nucleotide sequence: CGTGTTGATGCCGCGTATTTCTACTCTGCGACCGCTAATC
GCACAACTACGGCGCATAAAGATGAGACGCTGGCGATTAG DNA DOUBLE HELIX true singleParticle particle 0.25 8.0
30mM Tris 8.0, 150mM NaCl, 20mM EDTA, 5mM DTT and 0.1% glycerol
4/2 C-flat grids with a thin-layer of carbon over the holes
 ETHANE 100 100 FEI VITROBOT MARK IV Grids were rapidly plunged into liquid ethane using an FEI Vitrobot MarkIV maintained at 4 degrees C after being blotted for 4-4.5 seconds with a blotting force of 15-20. FEI TITAN KRIOS FLOOD BEAM BRIGHT FIELD FIELD EMISSION GUN 300 2.7 2.0 4.5 29000.0 FEI TITAN KRIOS AUTOGRID HOLDER Objective astigmatism was corrected at 210,000 times magnification
Data acquired using Leginon. We collected a 6 s exposure fractionated into 20, 300 ms frames with a dose of 8 electrons per square Angstrom per second.
2015-06-29 GATAN K2 SUMMIT (4k x 4k) 5600 48
CTFFind3
 C1 OTHER 6.0 OTHER Relion 50000 emd_3277.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 288 288 288 0 0 0 288 288 288 290.88 290.88 290.88 90.0 90.0 90.0 X Y Z -0.0103324 0.03063154 0.00005857 0.00134747 1.01 1.01 1.01 0.006 AUTHOR Reconstruction of Cas9 bound to sgRNA and 40-bp target DNA
::::EMDATABANK.org::::EMD-3277::::
emd_3277.png