REL PDBe PDBe PDBe 2015-10-20 2015-11-04 2015-11-04 2015-12-09 Cryo-EM structure of the E. coli replicative DNA polymerase complex bound to DNA (DNA polymerase III alpha, beta, and epsilon subunits) Fernandez-Leiro R Conrad J Scheres HWS Lamers MH DNA replication, DNA polymerase III alpha, DNA polymerase III beta, DNA polymerase III epsilon Fernandez-Leiro R Conrad J Scheres HWS Lamers MH Cryo-EM structures of the E. coli replicative DNA polymerase reveal dynamic interactions with clamp, exonuclease and Tau eLife 4 2015 26499492 doi:10.7554/eLife.11134 5fkw FULLOVERLAP DNA polymerase III catalytic complex DNA polymerase III catalytic complex
Individual proteins purified individually and the complex was later assembled in vitro and purified over gel filtration DNA polymerase subunit tau is not visible in this map due to comformational heterogeneity
1 DNA polymerase III alpha : 2 DNA polymerase III beta: 1 DNA polymerase III epsilon : 1 dsDNA 5 0.256 DNA polymerase III alpha Escherichia coli K12 0.132
amino acid residues 920-924 of E. coli PolIII alpha were changed by site directed mutagenesis from QADMF to QLDLF
1 1 true Escherichia coli BL21 (DE3) pET3d P10443 GO:0006260 GO:0003677 GO:0003887 IPR004805 DNA polymerase III beta Escherichia coli K12 0.081 1 2 true Escherichia coli BL21 (DE3) pET3d P0A988 GO:0006271 IPR001001 DNA polymerase III epsilon Escherichia coli K12 0.0273762
amino acid residues 182-187 of E. coli PolIII epsilon were changed by site directed mutagenesis from QTSMAF to QLSLPL
1 1 true Escherichia coli BL21 (DE3) pET3d P03007 GO:0004527 IPR006309 primer-template duplex DNA unidentified 0.0155
template strans has a 4 nucleotide overhang, sequence as follows: TCAGGAGTCCTTCGTCCTAGTACTACTCC
GGAGTAGTACTAGGACGAAGGACTC DNA DOUBLE HELIX true singleParticle particle 1 7.5
25 mM Hepes pH 7.5, 50 mM Potassium Glutamate, 3 mM Magnesium Acetate, 2 mM DTT
glow-discharged holey carbon cryo-EM grids (Quantifoil Cu R1.2/1.3 400 mesh)
 ETHANE 100 110 FEI VITROBOT MARK III Prior to sample preparation 0.1 volumes of 0.05% Tween 20 were added to the sample 3 microliters were pipetted onto the grid and blotted for 4 seconds FEI TITAN KRIOS FLOOD BEAM BRIGHT FIELD FIELD EMISSION GUN 300 2.7 2.0 4.0 64000.0 28409.0 FEI TITAN KRIOS AUTOGRID HOLDER 80 90 85 Objective lens astigmatism was corrected at 64,000 times magnification 2014-05-12 GATAN K2 QUANTUM (4k x 4k) 5 1350 40
20 frames/micrograph
32.
Particles were selected using automated particle picking with RELION Initial model was calculated with EMAN2 2D classification, 3D classification and 3D refinement was performed with RELION
each particle
 C1 7.3 OTHER RELION, ctffind3, EMAN2
Particle movement correction and b-factor weighting was performed with RELION
40582 200 emd_3202.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 128 128 128 0 0 0 128 128 128 225.28 225.28 225.28 90.0 90.0 90.0 X Y Z -0.07079408 0.16256787 -0.00000347 0.0099889 1.76 1.76 1.76 0.045 AUTHOR E. coli replicative DNA polymerase complex bound to DNA (DNA polymerase III alpha, beta, and epsilon subunits)
::::EMDATABANK.org::::EMD-3202::::
emd_3202.png
emd_3202_msk_1.map emd_3202_msk_1.map 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 128 128 128 0 0 0 128 128 128 225.28 225.28 225.28 90.0 90.0 90.0 X Y Z 0.0 1.0 0.04905649 0.19352578 1.76 1.76 1.76 mask for reconstructions
::::EMDATABANK.org::::
 emd_3202_fsc.xml