REL PDBe PDBe PDBe 2015-06-15 2015-07-15 2015-08-05 2015-08-19 Structure of a partial yeast 48S preinitiation complex in closed conformation Llacer JL Hussain T Ramakrishnan V Eukaryotic translation initiation, 48S, small ribosome subunit. Llacer JL Hussain T Marler L Aitken CE Thakur A Lorsch JR Hinnebusch AG Ramakrishnan V Conformational Differences between Open and Closed States of the Eukaryotic Translation Initiation Complex. MOL.CELL 59 399 412 2015 26212456 doi:10.1016/j.molcel.2015.06.033 3jap FULLOVERLAP Partial yeast 48S preinitiation complex Partial yeast 48S preinitiation complex 1 7 1.75 Ribosome small subunit false Kluyveromyces lactis 1.2 ribosome-eukaryote: SSU 40S, SSU RNA 18S Eukaryotic initiation factor 1 Saccharomyces cerevisiae Baker's yeast 0.0123 1 Monomer true Escherichia coli BL21(DE3) Rosetta pTYB2 P32911 Eukaryotic initiation factor 1A Saccharomyces cerevisiae baker's yeast 0.0174 1 Monomer true Escherichia coli BL21(DE3) Rosetta pTYB2 P38912 Eukaryotic initiation factor 2 Saccharomyces cerevisiae Baker's yeast 0.124
Uniprot codes are: alpha-P20459 beta-P09064 gamma-P32481
1 Three subunits, alpha, beta, gamma true Saccharomyces cerevisiae GP3511 Eukaryotic initiation factor 3 Saccharomyces cerevisiae Baker's yeast 0.395
Uniprot codes are: 3a-P38249, 3b-P06103, 3c-P32497, 3g-A6ZZ25, 3i-P40217
1 Five subunits, 3a, 3b, 3c, 3g, 3i true Saccharomyces cerevisiae GP3511 Initiator transfer RNA Saccharomyces cerevisiae Baker's yeast 0.023
Doble mutation (G31U:C39A) when compared with yeast WT initiator tRNA.
AGCGCCGUGGCGCAGUGGAAGCGCGCAGGUCUCAUAAACCUGAUGUCCUCGGAUCGAAACCGAGCGGCGCUACCA TRANSFER SINGLE STRANDED true Messenger RNA Saccharomyces cerevisiae 0.0074 GGAAUCUCUCUCUAUGCUCUCUCUC OTHER SINGLE STRANDED true singleParticle particle 0.17 6.5
20mM MES-KOH, 40mM K-acetate, 10mM NH4-acetate, 8mM Mg-acetate, 2mM DTT
Quantifoil R2/2 400 mesh copper grids with 4-5 nm thin carbon on top
 ETHANE 100 120 FEI VITROBOT MARK I 30 second incubation time Blot for 2.5-3 seconds before plunging FEI TITAN KRIOS FLOOD BEAM BRIGHT FIELD FIELD EMISSION GUN 300 2.7 1.5 4.0 78000.0 104478.0 GATAN LIQUID NITROGEN Objective lens astigmatism was corrected at 59,000 times magnification
Complete dataset was collected in 4 non-consecutive sessions
2014-07-04 FEI FALCON II (4k x 4k) 5500 27
Complete dataset was collected in 4 non-consecutive sessions
Particles were automatically picked with the autopicking tool of Relion
Each particle
 C1 4.9 OTHER Relion 21401 emd_3048.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 300 300 300 0 0 0 300 300 300 402.0 402.0 402.0 90.0 90.0 90.0 X Y Z -0.23441811 0.44270736 0.00030164 0.02307597 1.34 1.34 1.34 0.07 AUTHOR To see a continuous density for factors eIF1, eIF2, mRNA, entire tRNA and eIF3 at the 40S subunit interface, apply a Gaussian filtering of 1.34 and a contour level of 0.025. To see a continuous density for the PCI domain of eIF3, apply a Gaussian filtering of 2.5 and a contour level of 0.008.
::::EMDATABANK.org::::EMD-3048::::
 3J81 2 FLEXIBLE FIT Chimera, Coot, Refmac R-factor, FSC RECIPROCAL 3CW2 K FLEXIBLE FIT Chimera, Coot, Refmac R-factor, FSC RECIPROCAL 4U1C A C FLEXIBLE FIT Chimera, Coot, Refmac R-factor, FSC RECIPROCAL 4U1D A FLEXIBLE FIT Chimera, Coot, Refmac R-factor, FSC RECIPROCAL 4U1E B I G FLEXIBLE FIT Chimera, Coot, Refmac R-factor, FSC RECIPROCAL
emd_3048.png
emd_3048_fsc.xml