<emd emdb_id="EMD-2960" version="3.0.1.1" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="https://github.com/emdb-empiar/emdb-schemas/blob/master/v3/v3_0_1_1/emdb_relaxed.xsd">
    <admin>
        <current_status>
            <code>REL</code>
            <processing_site>PDBe</processing_site>
        </current_status>
        <sites>
            <deposition>PDBe</deposition>
            <last_processing>PDBe</last_processing>
        </sites>
        <key_dates>
            <deposition>2015-03-25</deposition>
            <header_release>2015-05-06</header_release>
            <map_release>2016-03-30</map_release>
            <update>2016-03-30</update>
        </key_dates>
        <title>Three Dimensional Dynamics and Fluctuations of DNA-Nanogold Dimers by Individual-Particle Electron Tomography</title>
        <authors_list>
            <author>Zhang L</author>
            <author>Smith JM</author>
            <author>Tong HM</author>
            <author>Zhang X</author>
            <author>Lei DS</author>
            <author>Lu ZY</author>
            <author>Alivisatos P</author>
            <author>Ren G</author>
        </authors_list>
        <keywords>3D structure, DNA-nanogold conjugate, individual-particle electron tomography, IPET</keywords>
    </admin>
    <crossreferences>
        <citation_list>
            <primary_citation>
                <journal_citation published="true">
                    <author order="1">Zhang L</author>
                    <author order="2">Smith JM</author>
                    <author order="3">Tong HM</author>
                    <author order="4">Zhang X</author>
                    <author order="5">Lei DS</author>
                    <author order="6">Lu ZY</author>
                    <author order="7">Alivisatos P</author>
                    <author order="8">Ren G</author>
                    <title>Three Dimensional Dynamics and Fluctuations of DNA-Nanogold Dimers by Individual-Particle Electron Tomography</title>
                    <journal>NAT.COMMUN.</journal>
                    <volume>7</volume>
                    <year>2016</year>
                </journal_citation>
            </primary_citation>
        </citation_list>
    </crossreferences>
    <sample>
        <name>Two 5-nm nanogolds bound to 84-base pair double-stranded DNA</name>
        <supramolecule_list>
            <sample_supramolecule supramolecule_id="1000">
                <name>Two 5-nm nanogolds bound to 84-base pair double-stranded DNA</name>
                <details>5 nm nanogold particles were stabilized via exchanging with bis-(p-sulfonatophenyl) phenylphosphine (BSPP). DNA sequences modified with a 5 thiol moiety were PAGE purified. DNA thiolated at the 5 end was re-suspended in buffer (10mM Tris pH 8, 0.5mM EDTA). Nanogold particles and DNA were combined at a stoichiometric ratio of 1:2 in the presence of a reducing agent. Monoconjugates formed were separated by anion exchange HPLC, and the fractions concentrated by an Amicon Ultra spin filter, MW 100,000 (EMD Millipore Corp, Billerica, MA). Twenty microliters of nanogold monoconjugates, each containing complementary strands of DNA, were combined stoichiometrically as determined by absorption at 520 nm and allowed to react overnight at room temperature. The dimers were purified from unreacted monoconjugates by agarose gel electrophoresis.</details>
                <oligomeric_state>Dimer</oligomeric_state>
                <number_unique_components>2</number_unique_components>
                <molecular_weight>
                    <experimental units="MDa">0.052</experimental>
                    <theoretical units="MDa">0.052</theoretical>
                    <method>Calculated from its sequence</method>
                </molecular_weight>
            </sample_supramolecule>
        </supramolecule_list>
        <macromolecule_list>
            <dna macromolecule_id="1">
                <name synonym="dsDNA">double-stranded DNA</name>
                <natural_source database="NCBI">
                    <organism ncbi="32630">synthetic construct</organism>
                </natural_source>
                <molecular_weight>
                    <experimental units="MDa">0.052</experimental>
                    <theoretical units="MDa">0.052</theoretical>
                </molecular_weight>
                <details>Two 5-nm nanogold bound to 84-base pair double-stranded DNA</details>
                <sequence>
                    <string>CCGGCGGCCCAGGTGTATCAGTGTTCGTTGCAAGCTCCAACATCTGAGTACCACGCATACTATACTTGAAATATCCGCGCCCGG</string>
                </sequence>
                <classification>DNA</classification>
                <structure>DOUBLE HELIX</structure>
                <synthetic_flag>true</synthetic_flag>
            </dna>
        </macromolecule_list>
    </sample>
    <structure_determination_list>
        <structure_determination structure_determination_id="1">
            <method>tomography</method>
            <aggregation_state>particle</aggregation_state>
            <specimen_preparation_list>
                <tomography_preparation preparation_id="1">
                    <concentration units="mg/mL">0.02</concentration>
                    <buffer>
                        <ph>7.4</ph>
                        <details>1X Dulbeccos phosphate-buffered saline (Invitrogen, La Jolla, CA), 2.7 mM KCl, 1.46 mM KH2PO4, 136.9 mM NaCl, and 8.1 mM Na2HPO4</details>
                    </buffer>
                    <staining>
                        <type>NEGATIVE</type>
                        <details>EM Specimens were prepared by optimized negative-staining EM specimen preparation protocol as described (Zhang L. and Ren G, Journal of Lipid Research, (2010) 51, 1228-1236 and (2011) 52, 175-84). In brief, nanogold-DNA dimer was diluted to 0.02 mg/ml with DPBS. Aliquots (about 4ul) were applied to the 200 mesh glow-discharged thin carbon-coated EM grids (Cu-200CN, Pacific Grid-Tech, USA). The grid was washed by deionized water for three times, and then washed by 1% uranyl formate for three times before blotting to drying.</details>
                    </staining>
                    <grid>
                        <details>200 mesh glow-discharged thin carbon-coated EM grids (Cu-200CN, Pacific Grid-Tech, USA)</details>
                    </grid>
                    <vitrification>
                        <cryogen_name>NONE</cryogen_name>
                        <instrument>OTHER</instrument>
                    </vitrification>
                </tomography_preparation>
            </specimen_preparation_list>
            <microscopy_list>
                <tomography_microscopy microscopy_id="1">
                    <microscope>ZEISS LIBRA120PLUS</microscope>
                    <illumination_mode>FLOOD BEAM</illumination_mode>
                    <imaging_mode>BRIGHT FIELD</imaging_mode>
                    <electron_source>LAB6</electron_source>
                    <acceleration_voltage units="kV">120</acceleration_voltage>
                    <nominal_cs units="mm">2.2</nominal_cs>
                    <nominal_defocus_min units="&#181;m">0.2</nominal_defocus_min>
                    <nominal_defocus_max units="&#181;m">0.5</nominal_defocus_max>
                    <nominal_magnification>125000.0</nominal_magnification>
                    <specimen_holder_model>OTHER</specimen_holder_model>
                    <alignment_procedure>
                        <legacy>
                            <astigmatism>Objective lens astigmatism was corrected at 125,000 times magnification</astigmatism>
                        </legacy>
                    </alignment_procedure>
                    <specialist_optics>
                        <energy_filter>
                            <name>ZEISS</name>
                            <lower_energy_threshold units="eV">0.0</lower_energy_threshold>
                            <upper_energy_threshold units="eV">20.0</upper_energy_threshold>
                        </energy_filter>
                    </specialist_optics>
                    <details>tilt step is 1.5 degree</details>
                    <date>2012-08-16</date>
                    <image_recording_list>
                        <image_recording>
                            <film_or_detector_model category="CCD">GATAN ULTRASCAN 4000 (4k x 4k)</film_or_detector_model>
                            <number_real_images>89</number_real_images>
                            <average_electron_dose_per_image units="e/&#8491;^2">1000</average_electron_dose_per_image>
                            <bits_per_pixel>16.</bits_per_pixel>
                        </image_recording>
                    </image_recording_list>
                    <specimen_holder>Gatan</specimen_holder>
                    <tilt_series>
                        <axis1>
                            <min_angle units="deg">-66</min_angle>
                            <max_angle units="deg">66</max_angle>
                            <angle_increment units="deg">1.5</angle_increment>
                        </axis1>
                    </tilt_series>
                </tomography_microscopy>
            </microscopy_list>
            <tomography_processing image_processing_id="1">
                <details>Micrographs were initially aligned together with the IMOD software package. The CTF was then corrected by TOMOCTF. The tilt series of particles in square windows of 512 pixels (~48 nm) were semi-automatically tracked and windowed by individual-particle electron tomography (IPET) software{eulerAnglesDetails}: Tomography tilt angle from -66 to 66 in step of 1.5</details>
                <final_reconstruction>
                    <algorithm>OTHER</algorithm>
                    <resolution res_type="BY AUTHOR" units="&#8491;">17.9</resolution>
                    <resolution_method>OTHER</resolution_method>
                    <software_list>
                        <software>
                            <name>IPET, FETR, Spider, IMOD, EMAN, and, EMAN2</name>
                        </software>
                    </software_list>
                    <details>Map was reconstructed by individual-particle electron tomography (IPET)and Focus ET Reconstruction Algorithm</details>
                    <number_images_used>89</number_images_used>
                </final_reconstruction>
                <ctf_correction>
                    <details>TOMOCTF</details>
                </ctf_correction>
            </tomography_processing>
        </structure_determination>
    </structure_determination_list>
    <map format="CCP4" size_kbytes="65537">
        <file>emd_2960.map.gz</file>
        <symmetry>
            <space_group>1</space_group>
        </symmetry>
        <data_type>IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES)</data_type>
        <dimensions>
            <col>256</col>
            <row>256</row>
            <sec>256</sec>
        </dimensions>
        <origin>
            <col>-128</col>
            <row>-128</row>
            <sec>-128</sec>
        </origin>
        <spacing>
            <x>256</x>
            <y>256</y>
            <z>256</z>
        </spacing>
        <cell>
            <a units="&#8491;">481.28</a>
            <b units="&#8491;">481.28</b>
            <c units="&#8491;">481.28</c>
            <alpha units="deg">90.0</alpha>
            <beta units="deg">90.0</beta>
            <gamma units="deg">90.0</gamma>
        </cell>
        <axis_order>
            <fast>X</fast>
            <medium>Y</medium>
            <slow>Z</slow>
        </axis_order>
        <statistics>
            <minimum>-0.51309508</minimum>
            <maximum>0.33203471</maximum>
            <average>0.00015647</average>
            <std>0.01243035</std>
        </statistics>
        <pixel_spacing>
            <x units="&#8491;">1.88</x>
            <y units="&#8491;">1.88</y>
            <z units="&#8491;">1.88</z>
        </pixel_spacing>
        <contour_list>
            <contour primary="true">
                <level>0.061</level>
                <source>AUTHOR</source>
            </contour>
        </contour_list>
        <annotation_details>Reconstruction of one particle of DNA-nanogold dimer by using individual-particle electron tomography.</annotation_details>
        <details>::::EMDATABANK.org::::EMD-2960::::</details>
    </map>
    <interpretation>
        <figure_list>
            <figure>
                <file>emd_2960.tif</file>
            </figure>
        </figure_list>
    </interpretation>
</emd>