REL PDBe PDBe PDBe 2015-03-25 2015-05-06 2016-03-30 2016-03-30 Three Dimensional Dynamics and Fluctuations of DNA-Nanogold Dimers by Individual-Particle Electron Tomography Zhang L Smith JM Tong HM Zhang X Lei DS Lu ZY Alivisatos P Ren G 3D structure, DNA-nanogold conjugate, individual-particle electron tomography, IPET Zhang L Smith JM Tong HM Zhang X Lei DS Lu ZY Alivisatos P Ren G Three Dimensional Dynamics and Fluctuations of DNA-Nanogold Dimers by Individual-Particle Electron Tomography NAT.COMMUN. 7 2016 Two 5-nm nanogolds bound to 84-base pair double-stranded DNA Two 5-nm nanogolds bound to 84-base pair double-stranded DNA
5 nm nanogold particles were stabilized via exchanging with bis-(p-sulfonatophenyl) phenylphosphine (BSPP). DNA sequences modified with a 5 thiol moiety were PAGE purified. DNA thiolated at the 5 end was re-suspended in buffer (10mM Tris pH 8, 0.5mM EDTA). Nanogold particles and DNA were combined at a stoichiometric ratio of 1:2 in the presence of a reducing agent. Monoconjugates formed were separated by anion exchange HPLC, and the fractions concentrated by an Amicon Ultra spin filter, MW 100,000 (EMD Millipore Corp, Billerica, MA). Twenty microliters of nanogold monoconjugates, each containing complementary strands of DNA, were combined stoichiometrically as determined by absorption at 520 nm and allowed to react overnight at room temperature. The dimers were purified from unreacted monoconjugates by agarose gel electrophoresis.
Dimer 2 0.052 0.052 Calculated from its sequence double-stranded DNA synthetic construct 0.052 0.052
Two 5-nm nanogold bound to 84-base pair double-stranded DNA
CCGGCGGCCCAGGTGTATCAGTGTTCGTTGCAAGCTCCAACATCTGAGTACCACGCATACTATACTTGAAATATCCGCGCCCGG DNA DOUBLE HELIX true tomography particle 0.02 7.4
1X Dulbeccos phosphate-buffered saline (Invitrogen, La Jolla, CA), 2.7 mM KCl, 1.46 mM KH2PO4, 136.9 mM NaCl, and 8.1 mM Na2HPO4
 NEGATIVE
EM Specimens were prepared by optimized negative-staining EM specimen preparation protocol as described (Zhang L. and Ren G, Journal of Lipid Research, (2010) 51, 1228-1236 and (2011) 52, 175-84). In brief, nanogold-DNA dimer was diluted to 0.02 mg/ml with DPBS. Aliquots (about 4ul) were applied to the 200 mesh glow-discharged thin carbon-coated EM grids (Cu-200CN, Pacific Grid-Tech, USA). The grid was washed by deionized water for three times, and then washed by 1% uranyl formate for three times before blotting to drying.
200 mesh glow-discharged thin carbon-coated EM grids (Cu-200CN, Pacific Grid-Tech, USA)
 NONE OTHER ZEISS LIBRA120PLUS FLOOD BEAM BRIGHT FIELD LAB6 120 2.2 0.2 0.5 125000.0 OTHER Objective lens astigmatism was corrected at 125,000 times magnification ZEISS 0.0 20.0
tilt step is 1.5 degree
2012-08-16 GATAN ULTRASCAN 4000 (4k x 4k) 81 1000 16. Gatan -60 60 1.5
Micrographs were initially aligned together with the IMOD software package. The CTF was then corrected by TOMOCTF. The tilt series of particles in square windows of 512 pixels (~48 nm) were semi-automatically tracked and windowed by individual-particle electron tomography (IPET) software{eulerAnglesDetails}: Tomography tilt angle from -60 to 60 in step of 1.5
OTHER 15.2 OTHER IPET, FETR, Spider, IMOD, EMAN, and, EMAN2
Map was reconstructed by individual-particle electron tomography (IPET)and Focus ET Reconstruction Algorithm
81
TOMOCTF
 emd_2953.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 256 256 256 -128 -128 -128 256 256 256 481.28 481.28 481.28 90.0 90.0 90.0 X Y Z -1.43617773 1.38186789 -0.00225854 0.06247903 1.88 1.88 1.88 0.285 AUTHOR Reconstruction of one particle of DNA-nanogold dimer by using individual-particle electron tomography.
::::EMDATABANK.org::::EMD-2953::::
emd_2953.tif