REL PDBe PDBe PDBe 2015-01-08 2015-02-11 2015-03-11 2015-09-16 2.9A structure of E. coli ribosome-EF-Tu complex by Cs-corrected cryo-EM Fischer N Neumann P Konevega AL Bock LV Ficner R Rodnina MV Stark H ribosome, translation, protein synthesis, decoding, elongation factor Tu, tRNA, RNA modification, antibiotic Fischer N Neumann P Konevega AL Bock LV Ficner R Rodnina MV Stark H Structure of the E. coli ribosome-EF-Tu complex at <3 A resolution by Cs-corrected cryo-EM NATURE 520 567 570 2015 25707802 doi:10.1038/nature14275 5afi FULLOVERLAP E. coli 70S-EF-Tu-GDP-kirromycin-Phe-tRNAPhe-fMet-tRNAfmet-tRNAfMet complex E. coli 70S-EF-Tu-GDP-kirromycin-Phe-tRNAPhe-fMet-tRNAfmet-tRNAfMet complex 6 2.8 70S ribosome false Escherichia coli ribosome-prokaryote: ALL elongation factor Tu Escherichia coli
EF-Tu-GDP stalled on the ribosome by the antibiotic kirromycin
true Phe-tRNAPhe Escherichia coli TRANSFER OTHER false initiator fMet-tRNAfMet Escherichia coli TRANSFER OTHER false deacylated tRNAfMet Escherichia coli TRANSFER OTHER false mRNA Escherichia coli GGCAAGGAGGUAAAUAAUGUUCGUUACGAC TRANSFER SINGLE STRANDED true singleParticle particle 7.5
50mM Hepes-KOH, 70mM NH4Cl, 30mM KCl, 20mM MgCl2, 1mM DTT, 0.6mM spermine, 0.4mM spermidine, 0.15mM kirromycin
Quantifoil grids (3.5/1um) covered with pre-floated continuous carbon
 ETHANE 100 FEI VITROBOT MARK IV FEI TITAN KRIOS SPOT SCAN BRIGHT FIELD OTHER 300 0.01 0.7 2.5 192000.0 FEI TITAN KRIOS AUTOGRID HOLDER Using a Cs-corrector from CEOS electron optical aberrations were corrected to residual phase errors of 45degree at scattering angles of >12 to 15 mrad. 2011-12-20 FEI FALCON I (4k x 4k) 24684 40
local CTF correction
 C1 2.9 OTHER custom-made, IMAGIC-5, Relion, 1.2 417201 emd_2847.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 420 420 420 0 0 0 420 420 420 317.205 317.205 317.205 90.0 90.0 90.0 X Y Z -2.42630196 4.7108736 0.0025036 0.21413666 0.75525 0.75525 0.75525 0.43 EMDB Structure of E. coli 70S-EF-Tu-GDP-kirromycin-Phe-tRNAPhe-fMet-tRNAfmet-tRNAfMet complex optimum contour level 0.32-0.64 (1.5-3 sigma)
::::EMDATABANK.org::::EMD-2847::::
emd_2847.jpg