REL PDBe PDBe PDBe 2014-08-28 2014-09-10 2014-09-10 2014-09-10 CMG helicase bound to DNA and ATPgS Costa A Renault L Swuec P Petojevic T Pesavento JJ Ilves I MacLellan-Gibson K Fleck RA Botchan MR Berger JM Helicase, AAA+ ATPase, DNA replication Costa A Renault L Swuec P Petojevic T Pesavento JJ Ilves I MacLellan-Gibson K Fleck RA Botchan MR Berger JM DNA binding polarity, dimerization, and ATPase ring remodeling in the CMG helicase of the eukaryotic replisome. elife 3 e03273 e03273 2014 25117490 doi:10.7554/eLife.03273 Drosophila melanogaster Cdc45-Mcm2-7-GINS complex bound to ATPgS and DNA Drosophila melanogaster Cdc45-Mcm2-7-GINS complex bound to ATPgS and DNA
The sample was monodisperse
13-mer 13 0.7 Mcm2 Drosophila melanogaster Fruit fly Nucleus 0.100 1 Monomer true unidentified baculovirus pFastBac-Mcm2 P49735 IPR008045 Mcm3 Drosophila melanogaster Fruit fly Nucleus 0.09 1 Monomer true unidentified baculovirus pFastBac-Mcm3 Q9XYU1 IPR008046 Mcm4 Drosophila melanogaster Fruit fly Nucleus 0.097 1 Monomer true unidentified baculovirus pFastBac-Mcm4 Q26454 IPR008047 Mcm5 Drosophila melanogaster Fruit fly Nucleus 0.082 1 Monomer true unidentified baculovirus pFastBac-Mcm5 Q9VGW6 IPR008048 Mcm6 Drosophila melanogaster Fruit fly Nucleus 0.092 1 Monomer true unidentified baculovirus pFastBac-Mcm6 Q9V461 IPR008049 Mcm7 Drosophila melanogaster Fruit fly Nucleus 0.081 1 Monomer true unidentified baculovirus pFastBac-Mcm7 Q9XYU0 IPR008050 Cdc45 Drosophila melanogaster Fruit fly Nucleus 0.066 1 Monomer true unidentified baculovirus pFastBac-Cdc45 O96989 IPR003874 Psf1 Drosophila melanogaster Fruit fly Nucleus 0.023 1 Monomer true unidentified baculovirus pFastBac-Psf1 Q9W0I7 IPR021151 Psf2 Drosophila melanogaster Fruit fly Nucleus 0.023 1 Monomer true unidentified baculovirus pFastBac-Psf2 Q9VQY9 IPR007257 Psf3 Drosophila melanogaster Fruit fly Nucleus 0.025 1 Monomer true unidentified baculovirus pFastBac-Psf3 Q9W2V7 IPR010492 Sld5 Drosophila melanogaster Fruit fly Nucleus 0.026 1 Monomer true unidentified baculovirus pFastBac-Sld5 Q9VBI1 IPR008591 LEAD60 unidentified 0.018271
The two oligonucleotides have been annealed to obtain a 20mer duplex DNA with a 40mer 3' overhang.
GGGCACTTGATCGGCCAACCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT DNA OTHER true 3BTNLAG20 unidentified 0.006569
The two oligonucleotides have been annealed to obtain a 20mer duplex DNA with a 40mer 3' overhang. 3BTNLAG20 contains a biotin on the 3' end (duplex end).
GGTTGGCCGATCAAGTGCCC DNA OTHER true singleParticle particle 0.02 7.6
25 mM HEPES , 50 mM sodium acetate, 10 mM magnesium acetate, 0.1 mM ATPgS, 1 mM DTT
 NEGATIVE
The grid with adsorbed protein was floated for 10 seconds on four consecutive 75 microliter drops of 2% w/v uranyl formate solution.
400 mesh copper grids with thin carbon support.
 NONE OTHER
The sample stained with a fresh 2% (wt/vol) uranyl formate solution.
 JEOL 2100 FLOOD BEAM BRIGHT FIELD LAB6 200 2 0.5 3.5 50000.0 70000.0 JEOL Objective lens astigmatism was corrected at 60,000 times magnification 2013-05-08 GATAN ULTRASCAN 4000 (4k x 4k) 15 579 35 32. single tilt room temperature
Particles were selected semi-automatically using e2boxer
EMAN2
 C1 OTHER 17.8 OTHER EMAN2, SPARX 29913
SPARX
 100 emd_2772.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 168 168 168 0 0 0 168 168 168 359.52002 359.52002 359.52002 90.0 90.0 90.0 X Y Z -0.32566851 0.81758922 0.00992203 0.0676895 2.14 2.14 2.14 0.37 AUTHOR Reconstruction of the recombinant Drosophila CMG helicase bound to ATPgS and DNA
::::EMDATABANK.org::::EMD-2772::::