REL PDBe PDBe PDBe 2013-09-07 2013-09-18 2013-11-13 2016-02-17 Cryo-EM structure of the CSFV IRES in complex with eIF3, small ribosomal 40S subunit and DHX29 Hashem Y des-Georges A Dhote V Langlois R Liao HY Grassucci RA Pestova TV Hellen CUT Frank J Internal Ribosomal Entry Site, 5'-end independent initiation, HCV-like IRES, eIF3/HCV-like IRES interaction Hashem Y des Georges A Dhote V Langlois R Liao HY Grassucci RA Pestova TV Hellen CU Frank J Hepatitis-C-virus-like internal ribosome entry sites displace eIF3 to gain access to the 40S subunit. NATURE 503 539 543 2013 24185006 doi:10.1038/nature12658 Reconstruction of a mutant Classical Swine Fever Virus IRES bound to eukaryotic initiation factor 3, the Rabbit 40S subunit and DHX29. Reconstruction of a mutant Classical Swine Fever Virus IRES bound to eukaryotic initiation factor 3, the Rabbit 40S subunit and DHX29. one 40S, one CSFV IRES, one eIF3 and one DHX29 4 2.6 eukaryotic small ribosmal subunit false Oryctolagus cuniculus Rabbit blood reticulocytes 1.5 ribosome-eukaryote: SSU 40S, SSU RNA 18S Internal Ribosomal Entry Site Classical swine fever virus CSFV 0.1 GACUAGCCGUAGUGGCGAGCUCCCUGGGUGGUCUAAGUCCUGAGUACAGGACAGUCGUCAGUAGUUCGACGUGAGCACUAGCCCACCUCGAGAUGCUACGUGGACGAGGGCAUGCCCAAGACACACCUUAACCCUGGCGGGGGUCGCUAGGGUGAAAUCACAUUAUGUGAUGGGGGUACGACCUGAUAGGGUGCUGCAGAGGCCCACUAGCAGGCUAGUAUAAAAAUCUCUGC OTHER DOUBLE HELIX true DHX29 Homo sapiens Human 0.15 1 Monomer true Escherichia coli eukaryotic initiation factor 3 Oryctolagus cuniculus Rabbit Blood Reticulocytes 0.85 1 Monomer false singleParticle particle 0.105 7.5
20 mM Tris , 75 mM KCl, 5 mM Mg, 2 mM DTT and 0.25 mM spermidine
300 mesh copper/molybdenum holey carbon-coated Quantifoil 2/4 grid (Quantifoil Micro Tools GmbH) containing an additional continuous thin layer of carbon
 ETHANE 100 120 FEI VITROBOT MARK II 30 seconds waiting after sample deposition on the grid, blotting for seconds before plunging FEI TECNAI F20 FLOOD BEAM BRIGHT FIELD FIELD EMISSION GUN 120 2.26 -1.0 -4.0 51570.0 OTHER 110 2013-02-01 GATAN ULTRASCAN 4000 (4k x 4k) 12000 12 32. Gatan CT3500 side-entry cryo-holder
The particles constituting this reconstruction were sorted using RELION.
Each particle
 C1 OTHER 9.3 OTHER Spider, Relion 26000 emd_2451.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 220 220 220 0 0 0 220 220 220 493.89996 493.89996 493.89996 90.0 90.0 90.0 X Y Z -0.04869587 0.14228088 0.00008203 0.01052825 2.245 2.245 2.245 0.0385 AUTHOR Reconstruction of a mutant Classical Swine Fever Virus IRES bound to eukaryotic initiation factor 3, the Rabbit 40S subunit and DHX29.
::::EMDATABANK.org::::EMD-2451::::