REL PDBe PDBe PDBe 2013-08-29 2013-09-04 2014-07-09 2014-07-09 Cryo-EM structure of T. thermophilus 30S Translation Initiation complex Simonetti A Marzi S Billas IML Tsai A Fabbretti A Myasnikov A Roblin P Vaiana AC Hazemann I Eiler D Steitz TA Puglisi JD Gualerzi GO Klaholz BP Translation Initiation complex, 30S, IF2, IF1, fMet-tRNA, mRNA, IF2 atomic model Simonetti A Marzi S Billas IML Tsai A Fabbretti A Myasnikov A Roblin P Vaiana AC Hazemann I Eiler D Steitz TA Puglisi JD Gualerzi GO Klaholz BP Involvement of IF2 N domain in ribosomal subunit joining revealed from architecture and function of the full-length initiation factor PROC.NAT.ACAD.SCI.USA 110 15656 15661 2013 24029017 doi:10.1073/pnas.1309578110 3j4j FULLOVERLAP Bacterial 30S Translation Initiation complex from T. thermophilus containing 30S, IF1, IF2, mRNA and fMet-tRNA. The structure have been used for modeling full atom IF2. Bacterial 30S Translation Initiation complex from T. thermophilus containing 30S, IF1, IF2, mRNA and fMet-tRNA. The structure have been used for modeling full atom IF2. monomer 5 0.9 30S
Thermus thermophilus 30S subunit purified from tight couple 70S ribosome
false Thermus thermophilus HB8 0.85 ribosome-prokaryote: SSU 30S, PSR16s Translation Initiation Factor 1 Thermus thermophilus HB8 0.008234 true Escherichia coli BL21(DE3) pET Q5SHR1 Translation Initiation Factor 2 Thermus thermophilus HB8 0.063178 true Escherichia coli BL21(DE3) pET P48515 mRNA synthetic construct
model mRNA
GGCAAGGAGGUAAAAAUGAAAAAAAAA OTHER SINGLE STRANDED true fMet-tRNA Escherichia coli
fMet-tRNA charged with Met and formylated
OTHER OTHER false singleParticle particle 0.5 7.5
10 mM Hepes (pH 7.5), 70 mM NH4Cl, 30 mM KCl, 8 mM MgAc2 and 1 mM DTT
QuantiFoil Grid 2/2
 ETHANE FEI VITROBOT MARK IV FEI POLARA 300 FLOOD BEAM BRIGHT FIELD FIELD EMISSION GUN 150 -1.5 -3.5 59000.0 82417.0 GATAN LIQUID NITROGEN 78 96 88 Objective lens astigmatism was corrected at 100,000 times magnification 2011-10-09 FEI EAGLE (4k x 4k) 1.82 200 15 16.
Particle selection was done semiautomatically with the BOXER routine of the EMAN2 software package followed by visual inspection. Defocus value estimation and contrast transfer function (CTF) correction by phase flipping were done using the program CTFIT from the EMAN2. Sample homogeneity was tested through 3D resampling and classification (3D-SC) using the IMAGIC suite, and structure determination and refinement were done using the EMAN2 software package.
Each particle
 C1 OTHER 11.5 OTHER EMAN2, IMAGIC 13000 emd_2448.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 208 208 208 -104 -103 -104 208 208 208 378.56 378.56 378.56 90.0 90.0 90.0 X Y Z -0.76591331 3.60590792 0.0375132 0.22922359 1.8199999 1.8199999 1.8199999 0.169 AUTHOR Bacterial 30S Translation Initiation complex from T. thermophilus containing 30S, IF1, IF2, mRNA and fMet-tRNA. The structure have been used for modeling full atom IF2.
::::EMDATABANK.org::::EMD-2448::::
 3J4J FLEXIBLE FIT DIREX
flexible fitting, dynamic elastic network
cross-correlation coefficient REAL