REL PDBe PDBe PDBe 2011-04-06 2012-02-17 2012-02-17 2012-10-24 EcoR124 Type I DNA restriction-modification enzyme complex in closed state with bound 30bp cognate DNA fragment. 3D reconstruction by single particle analysis from negative stain EM. Kennaway CK Taylor JE Song CF Potrzebowski W White JH Swiderska A Obarska-Kosinska A Callow P Cooper LP Roberts GA Bujnicki JM Trinick J Kneale GG Dryden DTF EcoR124, endonuclease, methyltransferase, type I restriction, DNA, HsdS, HsdM, HsdR, electron microscopy, negative stain, translocase, DEAD-box, ATPase Kennaway CK Taylor JE Song CF Potrzebowski W Nicholson W White JH Swiderska A Obarska-Kosinska A Callow P Cooper LP Roberts GA Artero JB Bujnicki JM Trinick J Kneale GG Dryden DT Structure and operation of the DNA-translocating type I DNA restriction enzymes. GENES DEV. 26 92 104 2012 22215814 doi:10.1101/gad.179085.111 EcoR124I R2 M2 S1 complex with 30 bp cognate dsDNA fragment EcoR124I R2 M2 S1 complex with 30 bp cognate dsDNA fragment
Stained with uranyl acetate
1x HsdS, 2x HsdM, 2x HsdR, 1x dsDNA 4 0.384 0.415 Small angle neutron scattering (SANS) EcoR124I HsdS specificity subunit Escherichia coli R Cytoplasmic 0.05 1 Monomer false GO:0005515 IPR000055 EcoR124I HsdM methyltransferase subunit Escherichia coli R cytoplasm 0.059 2 Dimer false GO:0005515 IPR003356 EcoR124I HsdR endonuclease subunit Escherichia coli R 0.12 2 monomer false GO:0009307 IPR004473 Deoxyribonucleic acid synthetic construct 0.015 CCGTGCAGAATTCGAGGTCGACGGATCCGG DNA DOUBLE HELIX true singleParticle particle 0.050 4.7
20mM Tris-Cl, 100 mM NaCl,
 NEGATIVE
Protein was adsorbed onto UV treated carbon for 1 minute, blotted, then 1% uranyl acetate solution was applied for 1 min then blotted, three times.
400 mesh copper
 NONE OTHER
Negative stain
 JEOL 1200EXII FLOOD BEAM BRIGHT FIELD TUNGSTEN HAIRPIN 80 2.0 0.405 0.991 40000.0 JEOL 294 Corrected at 80,000x
Customised JEOL 1200 EX microscope, low dose mode.
2010-09-01 KODAK SO-163 FILM OTHER 15 30 40
Scanned on Imacon scanner
8. Side entry
The particles were manually selected using boxer.
Filtered at 1st zero
 C2 OTHER 21.0 FSC 0.5 CUT-OFF EMAN, IMAGIC
Refined in Imagic using anchor set. C2 symmetry imposed.
3806
Euler angle range limited to plus minus 30 degrees from single axis of rotation
 100 emd_1890.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 80 80 80 -40 -40 -40 80 80 80 316.8 316.8 316.8 90.0 90.0 90.0 X Y Z -0.54730725 1.30585396 0.01822406 0.11469037 3.96 3.96 3.96 0.43 AUTHOR EcoR124I R2 M2 S1 complex with 30bp DNA fragment bound (closed state). DNA is not visible in the negative stain images or map.
::::EMDATABANK.org::::EMD-1890::::
 2W00 A RIGID BODY FIT Chimera
PDBEntryID_givenInChain. Protocol: rigid body. HsdR (2W00) was fitted into the density after the core methylase (HsdS and 2x HsdM) was fitted.
cross-correlation RECIPROCAL