REL PDBe PDBe PDBe 2010-10-18 2011-01-14 2011-01-14 2011-01-14 Cryo-electron tomography derived density map of a conserved retroviral RNA packaging element from Moloney Murine Leukemia Virus. Miyazaki Y Irobalieva RN Tolbert B Smalls-Mantey A Iyalla K Loeliger K DSouza V Khant H Schmid MF Garcia E Telesnitsky A Chiu W Summers MF cryo-ET, tomography,retroviral RNA, MoMuLV, Moloney Murine Leukemia Virus, double hairpin Miyazaki Y Irobalieva RN Tolbert BS Smalls-Mantey A Iyalla K Loeliger K D'Souza V Khant H Schmid MF Garcia EL Telesnitsky A Chiu W Summers MF Structure of a conserved retroviral RNA packaging element by NMR spectroscopy and cryo-electron tomography. J.MOL.BIOL. 404 751 772 2010 20933521 doi:10.1016/j.jmb.2010.09.009 MLV Tandem Hairpin RNA MLV Tandem Hairpin RNA
RNA synthesized by in vitro transcription and purified by polyacrylamide gel electrophoresis. Sequence of the RNA confirmed by NMR.
Homodimer 1 0.0428 Not determined but identity confirmed by NMR MLV Tandem Hairpin RNA Moloney murine leukemia virus Moloney Murine Leukemia Virus 0.0428 GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGGG OTHER SINGLE STRANDED false subtomogramAveraging 1.03 7.0
Tris buffer, pH 7.0, containing 140 mM KCl and 2 mM MgCl2
200 mesh gold grid
 ETHANE 100 FEI VITROBOT MARK III
Vitrification instrument: Vitrobot Mark III
1 blot, 1 second JEOL 2200FSC OTHER BRIGHT FIELD FIELD EMISSION GUN 200 2 20000.0 23123.0 GATAN LIQUID NITROGEN 98 98 98 Objective lens astigmatism was corrected at 100,000 times magnification In column Omega-type filter GENERIC GATAN (4k x 4k) 85 Gatan 70 degree holder -60 60
Tomogram was reconstructed using IMOD. Average number of tilts used in the 3D reconstructions: 60. Average tomographic tilt angle increment: 2.
OTHER IMOD
Final map was an average of 38 subvolumes.
 emd_1806.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 64 64 64 -31 -35 -32 64 64 64 415.168 415.168 415.168 90 90 90 X Y Z -8.041969999999999 25.148700000000002 0.00000000256321 1.0 6.487 6.487 6.487 8.0 AUTHOR The final average of 38 subvolumes of two sets of two stem loop structures (CD2) of MoMuLV.
::::EMDATABANK.org::::EMD-1806::::
 2L1F Chimera, X-plor
Protocol: Distance geometry refinement with the Cyana software package using NMR-derived restraints. The cryo-ET data were not employed as refinement restraints. The determined NMR structure (2LIF) was fitted into the cryo-ET density map using Chimera and X-plor.
Lowest target functions, equals sum of the square of the distance and angle restraint violations REAL