2024-07-24 REL PDBe PDBe PDBe 2022-04-08 2023-04-19 2023-04-19 2024-07-24 Danish Council for Independent Research Denmark Ligand bound state of a brocolli-pepper aptamer FRET tile McRae EKS Vallina NS Hansen BK Boussebayle A Andersen ES RNA origami aptamer fret, RNA McRae EKS Vallina NS Hansen BK Boussebayle A Andersen ES Structure determination of Pepper-Broccoli FRET pair by RNA origami scaffolding To Be Published 0353 Afonine PV Poon BK Read RJ Sobolev OV Terwilliger TC Urzhumtsev A Adams PD Rea-space refinement in PHENIX for cryo-EM and crystallography. Acta Crystallogr D Struct Biol 74 531 544 2018 doi:10.1107/S2059798318006551 2059-7983 Croll TI ISOLDE: a physically realistic environment for model building into low-resolution electron-density maps. Acta Crystallogr D Struct Biol 74 519 530 2018 29872003 doi:10.1107/S2059798318002425 2059-7983 Punjani A Rubinstein JL Fleet DJ Brubaker MA cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nat Methods US 14 290 296 2017 doi:10.1038/nmeth.4169 1548-7105 7zj4 FULLOVERLAP Ligand bound state of a brocolli-pepper aptamer FRET tile Ligand bound state of a brocolli-pepper aptamer FRET tile 0 1 synthetic construct 0.12 brocolli-pepper aptamer synthetic construct 0.12070095299999999 1 GGAUACGUCUACGCUCAGUGACGGACUCUCUUCGGAGAGUCUGACAUCCGAACCAUACACGGAUGUGCCUCGCCGAACAG UCUACGGCGAGCUUAAGCGCUGGGGACGCCCAACGCAUCACAAAGACUGAGUGAUGAACCAGAAGUAUGGACUGGUUGCG UUGGUGGAGACGGUCGGGUCCAGUUCGCUGUCGAGUAGAGUGUGGGCUCCAUCGACGCCGCUUUAAGGUCCCCAAUCGUG GCGUGUCGGCCUGCUUCGGCAGGCACUGGCGCCGGGACCUUGAAGAGAUGAGAUUUCGAUCUCAUCUUUGGGUGUCUCUG GUGCUUGAGGGCCCUGUGUUCGCACAGGGCCGCUCACUGGGUGUGGACGUAUCC 4-[(~{Z})-1-cyano-2-[5-[2-hydroxyethyl(methyl)amino]thieno[3,2-b]thiophen-2-yl]ethenyl]benzenecarbonitrile 0.000365472 1 J93 4-(3,5-difluoro-4-hydroxybenzyl)-1,2-dimethyl-1H-imidazol-5-ol 0.000254233 1 1TU POTASSIUM ION 3.9098e-05 1 K singleParticle particle 2.5 7.5
40mM HEPES pH 7.5, 5mM MgCl2, 50mM KCl. Filtered through 0.22 um filter.
 UltrAuFoil R1.2/1.3 GOLD 300 GLOW DISCHARGE OTHER 0.00045000000000000004
15mA of current.
 ETHANE 100 288 LEICA EM GP
3 uL sample, blotted onto double layer of whatman filter paper for 6 seconds..
Sample was purified by size exclusion chromatography.
 FEI TITAN KRIOS FLOOD BEAM BRIGHT FIELD FIELD EMISSION GUN 300 2.7 0.7000000000000001 2.0 GIF Bioquantum 20 GATAN K3 BIOQUANTUM (6k x 4k) 1 5354 60.0
Collected with a calibrated pixel size of 0.647 Angstrom
 1 729630
Picked from templates generated from an ab initio model
 1 C1 4.43 FSC 0.143 CUT-OFF cryoSPARC 3
Local refinement was performed using a mask covering the entire volume.
150204 MAXIMUM LIKELIHOOD cryoSPARC 3 MAXIMUM LIKELIHOOD cryoSPARC 3 5 75000.0 cryoSPARC 3 emd_14740.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 216 216 216 0 0 0 216 216 216 278.63998 278.63998 278.63998 90.0 90.0 90.0 X Y Z -0.24302302 0.7123579 0.0006073777 0.018451815 1.29 1.29 1.29 0.14 AUTHOR Map sharpened with b-factor of 160 7PTQ PDB experimental model 7EOP PDB experimental model FLEXIBLE FIT REAL emd_14740_msk_1.map emd_14740_additional_1.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 216 216 216 0 0 0 216 216 216 278.63998 278.63998 278.63998 90.0 90.0 90.0 X Y Z -0.061124343 0.41137066 0.00060737773 0.015206131 1.29 1.29 1.29 AUTHOR Unsharpened map emd_14740_half_map_2.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 216 216 216 0 0 0 216 216 216 279.504 279.504 279.504 90.0 90.0 90.0 X Y Z -0.1555132 0.49624208 0.00058955234 0.025495311 1.294 1.294 1.294 AUTHOR Half map A emd_14740_half_map_1.map.gz 1 IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) 216 216 216 0 0 0 216 216 216 279.504 279.504 279.504 90.0 90.0 90.0 X Y Z -0.14942554 0.48784435 0.00058732653 0.025386805 1.294 1.294 1.294 AUTHOR Half map B